PlasmoReturns » Shared Projects (642)
-
MY BAGS. GOODBAI! by PlasmoReturns
-
Add yourself Laughing at fat Mario remix remix remix remix by PlasmoReturns
-
Make Us Look Pixelified! (No Effect Script.) by PlasmoReturns
-
THE FORCE by PlasmoReturns
-
Stupid Muryo by PlasmoReturns
-
W.I.P! by PlasmoReturns
-
add yourself going crazy on the moon remix by PlasmoReturns
-
But Im Not Eat Dat Ok? by PlasmoReturns
-
Daredevil remix by PlasmoReturns
-
give me character and i will slirify it remix by PlasmoReturns
-
add_urself...IN_KIRBY_FORM!!!That shouldn't be hard!! remix by PlasmoReturns
-
Do NWWK Mew And Me. by PlasmoReturns
-
Lol-3 by PlasmoReturns
-
Add Yourself fighting On Dog Bridge! (REMAKE!) by PlasmoReturns
-
pichu 22 26 Players Minigame remix remix remix remix by PlasmoReturns
-
battle for 200$ REBOOT EP 1 remix by PlasmoReturns
-
BATTLE FOR 200 $ REBOOT 12/15 remix by PlasmoReturns
-
Team? by PlasmoReturns
-
Fixed KittieCat Bolt V2 by PlasmoReturns
-
Do Bolt001 V1 And V2. by PlasmoReturns
-
Xomic13 So Dead M8 by PlasmoReturns
-
Do Bolt001 by PlasmoReturns
-
New Look! by PlasmoReturns
-
YOU ARE DED. NOT BIG SERPRIZE. by PlasmoReturns
-
Add yourself riding your own Warpstar! remix remix by PlasmoReturns
-
Coming Through! by PlasmoReturns
-
You Are Now Ded. by PlasmoReturns
-
by PlasmoReturns
-
CRITICAL HIT ALERT!!! by PlasmoReturns
-
ded manuel stupid head remix by PlasmoReturns
-
Ok Guys, I'm On Now. by PlasmoReturns
-
Welcome :/ by PlasmoReturns
-
Ok. Do These Twin (I Guess) Guys by PlasmoReturns
-
RPG SAUS! :D by PlasmoReturns
-
Frozen Rifle Attack! by PlasmoReturns
-
Add yourself at the Table and Chairs! by PlasmoReturns
-
Looks Like It's My Turn Now! by PlasmoReturns
-
120 Remix Level Challenge 007 by PlasmoReturns
-
Transported To The Underground Biolab. by PlasmoReturns
-
Scrars Family PT1 V28 remix by PlasmoReturns
-
Follower Fight Area! by PlasmoReturns
-
My Follower Studio's Icon. by PlasmoReturns
-
I'm Just Defending Myself With This. by PlasmoReturns
-
VIRUS SIMULATOR?! HARDER (I Guess) by PlasmoReturns
-
This Was Never The Constantine I Knew... by PlasmoReturns
-
Add Yourself Fighting In Call Of Mini! by PlasmoReturns
-
Add Yourself As An Amiibo!! remix by PlasmoReturns
-
Do These Guys. by PlasmoReturns
-
Call Of Mini 1/2 Stuff. by PlasmoReturns
-
Last One. by PlasmoReturns
-
New Lip-Sync (Vector) W.I.P by PlasmoReturns
-
Retry, Maybe... by PlasmoReturns
-
Yesh. remix by PlasmoReturns
-
SCRETCH CAAAAAAAAATTTTTTTTTT by PlasmoReturns
-
Did I Do It Right by PlasmoReturns
-
I Just Don't Know Who I Made by PlasmoReturns
-
Kthen by PlasmoReturns
-
Ok Ok by PlasmoReturns
-
Hai I'm Kirby by PlasmoReturns
-
BAAAAAAAAAAAAAAAAAAAAAAa by PlasmoReturns





























































