maya-cg » Favorites (40)
-
![]()
POKEMON GO! :P remix-2
by maya-cg
-
![]()
Eternal Apprentice // Chapter 83
by MeadowFoot_ToPH
-
![]()
minecraft platform
by ajackson909
-
![]()
Doomed Doomsday in Doom Town
by maya-cg
-
![]()
Naruto and Sasuke Intro
by AvyuktN
-
![]()
Taco Party!
by IvyS-cg
-
![]()
Poopy life dress up
by maya-cg
-
![]()
Remix if you agree =) remix
by cat_lover_360
-
![]()
Chicken guy
by hjg116
-
![]()
Poopy stories
by maya-cg
-
![]()
funny Chicken
by hjg116
-
![]()
kinger spin.
by Socks_my_beloved1
-
![]()
The Amazing Digital Circus Vector Pack
by ReinhartG
-
![]()
Caine From The Amazing Digital Circus!!
by UltraSans27
-
![]()
Wings of balls
by AahilS-cg
-
![]()
penguin bake maze (only on computer)
by AahilS-cg
-
![]()
Let's Make Pride Cake!
by AquaLeafStudios
-
![]()
Let's Make Candies!
by AquaLeafStudios
-
![]()
Let's Make Pie!
by AquaLeafStudios
-
![]()
geometrey dash cat remix
by IvyS-cg
-
![]()
kittie yo!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
by maya-cg
-
![]()
Hypnotize machine
by KaiH-cg
-
![]()
yo mama!
by maya-cg
-
![]()
adorable kissing koalas!!!
by maya-cg
-
![]()
Poo poo butt
by maya-cg
-
![]()
☆ᴋʀꜱᴘᴀ'ꜱ ᴄᴀᴛ ᴄᴀꜰᴇ!!
by Krspa
-
![]()
happening! ⚘ template (CCE // loop)
by CapitanFluffy
-
![]()
Eternal Apprentice // Chapter 17
by MeadowFoot_ToPH
-
![]()
The 8 Scratch Cats
by IvyS-cg
-
![]()
POKEMON GO! :P
by JeffAnimations
-
![]()
POKEMON GO! :P remix
by maya-cg
-
![]()
flying cat (NOT FLYING)
by Alexfrp2013
-
![]()
Lights - A Platformer Game Easy Mode
by Alexfrp2013
-
![]()
Ancient Egypt - A Platformer (Educational)
by TutoeTurtle
-
![]()
catcatcatcatcatcatcatcatcat
by maya-cg
-
![]()
Grunckle Stan the Idiot
by maya-cg
-
![]()
°○ Buttercup ➵ kitten animation meme ○°
by tildyk
-
![]()
Curly things
by maya-cg
-
![]()
Let's not make mardi grass dishes
by maya-cg
-
![]()
ABC Learning
by maya-cg
