element83
Scratcher Joined 2 years, 11 months ago Antarctica
About me
aa wagwag wgaa aaaa agw wag gwag
they/them
my genome is GCATGCGATGACTTAGCTGTCGTATATCGAGTCGATATATACGACGTCGACGTAGTCAGTATTCGAGTCAGTCTGACGGTCGTCGTACAATGATCGTAGCTGATCGATGCATGCTATCGATGCTAGTCAGTGCATCGATCGTAA
What I'm working on
emitting sodium chlorinated dihydrogen monoxide from my eyes
rest in peace astronomical
they knew how to count real good
What I've been doing
Shared Projects (18)
View all-
am i online by element83
-
Sentence Destroyer by element83
-
How do electrons generate electricity? by element83
-
Saturday Evening Swingin' (very old) by element83
-
bismuthPC by element83
-
get your perscription refilled by element83
-
watch this block of francium-221 by element83
-
ruh roh raggy by element83
-
amayah's bad math day by element83
-
amayah goes to school by element83
-
multi-use astronomical calculator by element83
-
nah by element83
-
Solar System Loudness Visualizer by element83
-
RNG Solar System by element83
-
gnap gnap-9 system in motion by element83
-
gnarp gnap-9 by element83
-
stanley simulator by element83
-
stanley from tsp says letters and then moves by element83
Favorite Projects
View all-
we ARE lesbians by PeteyBirdd
-
Atom Builder [v. 1.2.10] by krish15
-
Frosted Forest by amazingmike888
-
Dreamazon - PGMA Round 3 by EnderPlaySmash
-
Powers out - Nickyle by vibe_YT
-
Levitate || #art by SWL_
-
Toby's Fault (Animation) by Pciphidic
-
[] hand tutorial [] by 8thHologramicSquid
-
Ep. 1- Real Talk- Colors! by LanaTheLampshade
-
✲_拡散希望_✲ The Exit 8 3D _ 8番出口 3D by penguin_282
-
Shopping Simulator (2024) by The-Nick-of-Time
-
(fw!) Dust Dust Curse || Animation meme template by Floofy_Raptor889
-
windOS 2024 Preview by WindowsBammer
-
How information was sent by Interesting_Stuff_MG
-
Get Funky with the #Chunky by FireDuck6607
-
Snow v2.0 by SpartanDav
-
Computer Battery by VintageRecord10
-
My second animation :D by Nylesshapecreator1
-
The Abacus v0.2.7 by jpkjpkjpkjpkjpk
-
printer simulator by CosmicScratcher242
Studios I'm Following
View all-
The World of Technology
-
Calling All Scratchers!
-
2023: A Year in Review
-
Super School
-
pluto's reprisal vectors
-
Pluto's reprisal but my way part 4
-
other pluto's reprisal things
-
Make-a-Friend Centre!
-
Star Gazers - Scratch Camp 2023
-
Space
-
follow this if u think grassy needs respect
-
Welcome to Astronomy!
-
CTCW Official Studio
-
Orbital Rockets
Studios I Curate
View allFollowing
View allFollowers
View allComments
- Comments loading...














































































