sunpup33 » Shared Projects (1509)
-
The Prohecy by sunpup33
-
Beach warrior (a tale begins) by sunpup33
-
hey, by sunpup33
-
The legend of the cave dwellers by sunpup33
-
Sparky! (I CANT STOP ARTING..) by sunpup33
-
New varient of sun enters the room by sunpup33
-
budsforbuddies bases remix by sunpup33
-
Warriors:choose your path(WIP) by sunpup33
-
v3nt collab remix remix-2 remix remix remix remix remix remix remix remix remix remix remix by sunpup33
-
v3nt collab remix remix-2 remix remix remix remix remix remix remix remix remix by sunpup33
-
v3nt collab remix remix-2 remix remix remix remix remix remix remix by sunpup33
-
v3nt collab remix remix-2 remix remix remix remix remix by sunpup33
-
v3nt collab remix remix-2 remix remix remix by sunpup33
-
v3nt collab remix remix-2 remix by sunpup33
-
v3nt collab remix by sunpup33
-
tweening pratice by sunpup33
-
fishing mini game by sunpup33
-
Untitled-454 by sunpup33
-
CRABPELT :D by sunpup33
-
cringe animation by sunpup33
-
cabbit oc by sunpup33
-
grey strip and millie's kits by sunpup33
-
C00LKID by sunpup33
-
pov:when u arted by sunpup33
-
Untitled-442 by sunpup33
-
pop rocks by sunpup33
-
butter cup by sunpup33
-
rain (tweening test) by sunpup33
-
..? SMUDGE COME BACK!! by sunpup33
-
Smores eatin a smore by sunpup33
-
Untitled-409 by sunpup33
-
CAR by sunpup33
-
Smores by sunpup33
-
Voice claims for the The 2 eevees by sunpup33
-
catatattatatatatatatatatatataat atattatatataat by sunpup33
-
Pokmon loc remix by sunpup33
-
the cat by sunpup33
-
Collab with me! warrior cats collab remix by sunpup33
-
mwhehehehehehe by sunpup33
-
CAT LOOKING CREATURE SAYS HI by sunpup33
-
hueheueheu by sunpup33
-
angrer the cat by sunpup33
-
REMIX THIS UNTIL WE REACH INFINITY REMIXES!!!!!!! remix remix remix remix by sunpup33
-
tbh n btw sitin by sunpup33
-
tbh N btw by sunpup33
-
yatta tween by sunpup33
-
Untitled-417 by sunpup33
-
I dont get it ! ft.moonpaw by sunpup33
-
Untitled-413 by sunpup33
-
vector animation by sunpup33
-
Spirgatito vector by sunpup33
-
Eevee animation by sunpup33
-
Collab with Mateo (4) remix by sunpup33
-
Collab with Mateo (2) remix by sunpup33
-
Collab with Mateo (1) by sunpup33
-
scracth cat redeissign by sunpup33
-
by sunpup33
-
The eevee buddies!:ep1 Cookie jar by sunpup33
-
Packs of Spirit SignUp remix by sunpup33
-
Pokemon life! the REBOOT! Chapter 7 by sunpup33





























































