sunpup33
Scratcher Joined 1 year, 1 month ago United States
About me
Hi! I'm sunpup33 :D I make animations when I feel like it, and sometimes games! (and cringy stuff. -_-)
What I'm working on
What I've been doing
Shared Projects (100+)
View all-
name ideas? by sunpup33
-
Voice claims for the The 2 eevees by sunpup33
-
catatattatatatatatatatatatataat atattatatataat by sunpup33
-
Pokmon loc remix by sunpup33
-
the cat by sunpup33
-
Collab with me! warrior cats collab remix by sunpup33
-
mwhehehehehehe by sunpup33
-
CAT LOOKING CREATURE SAYS HI by sunpup33
-
hueheueheu by sunpup33
-
angrer the cat by sunpup33
-
REMIX THIS UNTIL WE REACH INFINITY REMIXES!!!!!!! remix remix remix remix by sunpup33
-
tbh n btw sitin by sunpup33
-
tbh N btw by sunpup33
-
yatta tween by sunpup33
-
Untitled-417 by sunpup33
-
I dont get it ! ft.moonpaw by sunpup33
-
Untitled-413 by sunpup33
-
vector animation by sunpup33
-
Spirgatito vector by sunpup33
-
Eevee animation by sunpup33
Favorite Projects
View all-
!FW! FANCY COMPUTER | ᴍᴇᴍᴇ ᴛᴇᴍᴘʟᴀᴛᴇ by PurpleBand-aids
-
communication by Mondlicht-Kunst
-
Shattered - A Warriors Game by Rivershine2222
-
Life as an apprentice..Game by SproutCodeZ
-
Be a warrior cat! (demo) by tarrasic
-
Classical Music Playlist by cheekyscuola
-
i am the globglogabgalab by GlobglogabgaIab
-
Cat Avatar Creator - Derp Edition by AllyCat_711
-
Wrong Finger [Re-Imagined] [BFDI Animation] [Unfinished] by OffBrandItems
-
Foxes Warriors by Quagsire
-
Warriors game base! by ChocoChipKookie-1
-
- Starlight: Finale - by _-Galaxy_-
-
Minecraft Music Disc Player (All 12 Discs!) +pigstep! by FFerb
-
Red Mountain: A RPG (WIP V.2) by StormStar1515
-
Those Who Seek Eternity... by 10016927
-
Broken Cycle by 10016927
-
The Life of a Warrior by JoandJon
-
Warriors Game!! by warriors4311
-
- Lostwoods - v3-ish - by Sand_Boa
-
- Lostwoods - v2 by 10016927
Studios I'm Following
View all-
Warrior Cat Lovers
-
actual good warriors games/favs
-
Warrior Cats Scratch Adaptation (Episodes)
-
Pebble and Coal Projects
-
♥ Shipping Studio ♥
-
Here
-
Come
-
The
-
Grannies
-
⊰ kitten ♡ chapter collection ⊱
-
StopScratchAI Army
-
wolves and warrior cats
-
Pokemon life BLOLOOLOL
-
Worldwide Scratchers
-
W O B B L E D O G .
-
Wobbledogs
-
Furies ’n’ therians!
-
your mom
-
Scratchers against AI “art”
-
The crystal fan club!!
Studios I Curate
View all-
Pokemon life the reboot
-
Add any animal or furry project!
-
Fox: Official comic studio
-
the moon pack RP
-
⭐❤️Furry Fanclub❤️⭐
-
Untitled Studio
-
Autism Acceptance Studio!!! ❤️
-
Forest's Revenge Rp (Dawn Hunters)
-
ANTI-ROCK MOVEMENT
-
Blue Crew
-
uh rndom stuff
-
Untitled Studio
-
furry=follow
-
pebble and milk shake studio
-
A random studio
-
my frutureMDOG
-
our dead pets
-
my baby future baby puppy
-
kitten and german shepherd
-
Bluey Chatting Room (Version 0.5)
Following
View allFollowers
View allComments
Sorry, comment posting has been turned off for this user profile.
- Comments loading...