miky-yo-33 on Scratch

Share

miky-yo-33

Scratcher Joined 1 year ago United States

About me

I'm cool and stuff

What I'm working on

‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽‽‽‽‽‽‽‽‽
‽‽

Featured Project

What I've been doing

Shared Projects (88)

look by miky-yo-33
derpy snake 2 by miky-yo-33
derpy snake by miky-yo-33
hajaguguguguguguugugugugugug by miky-yo-33
Undertall (not done) by miky-yo-33
Undetistik by miky-yo-33
game by miky-yo-33
un real siting by miky-yo-33
cat jumping over stuff with a item that goes pew-pew 3 by miky-yo-33
Sprunki Vector Pack 1 remix by miky-yo-33
hajaguguguguguu by miky-yo-33
milk by miky-yo-33
cat jumping over stuff with a item that goes pew-pew 2 by miky-yo-33
uhwvduyvwfubhgvfwhubjfve by miky-yo-33
cat jumping over stuff with a item that goes pew-pew by miky-yo-33
nyan cat by miky-yo-33
hornet headlines by miky-yo-33
higugugugug by miky-yo-33
mister burns adventure by miky-yo-33
look by miky-yo-33

Favorite Projects

Studios I'm Following

Studios I Curate

Followers

Comments

Comments loading...

Mobilize your Website

View Site in Mobile | Classic

Share by: